• شماره مدرك
    4656
  • شماره راهنما
    4384
  • پديد آورنده

    ذوالفقاري، سميه

  • عنوان

    شناسايي و مقايسه عملكرد لاكتوباسيلوس بولگاريكوس موجود در ماست هاي محلي و صنعتي موجود در بازار ايران به منظور بررسي توانايي صنعتي شدن در آغازگرهاي بومي

  • مقطع تحصيلي
    كارشناسي ارشد
  • گرايش تحصيلي
    علوم و صنايع غذايي
  • محل تحصيل
    اصفهان: دانشگاه صنعتي اصفهان،دانشكده كشاورزي
  • سال دفاع
    1387
  • صفحه شمار
    ده، [152] ، [II]ص.: نمودار، جدول
  • يادداشت
    ص.ع.به: فارسي و انگليسي
  • توصيفگر ها

    توليد اگزوپلي ساكاريد , آزمون كاتالاز

  • دانشكده
    مهندسي كشاورزي
  • كد ايرانداك
    ID4384
  • چكيده فارسي
    به فارسي و انگليسي: قابل رويت در نسخه ديجيتال
  • چكيده انگليسي
    Identification and comparison of technological properties of Lactobacillusbulgaricus present in local and industrial yoghurts in order to determinepotential of local starters to be used in yoghurt industrySomayeh Zolfaghari14 1 2009Department of Food Science and TechnologyIsfahan University of Technology Isfahan 8415683111 IranDegree M Sc Language FarsiSupervisors Dr M Sheikh Zeinoddin zeinodin@cc iut ac irDr S Soleimanian Zad soleiman@cc iut ac irAbstractStarter culture used in yoghurt processing is normally a mixture of Lactobacillus delbrueckii subsp bulgaricus known as Lactobacillus bulgaricus and Streptococcus salivarius subsp thermophilus known as Streptococcusthermopiles It is known that more rapid acid development is observed in mixed cultures of two bacteria thanin the single strain cultures due to a symbiotic relationship between these two species of bacteria Lactobacillusbulgaricus is a gram positive thermophilic microorganism used in the production of numerous dairy products including Swiss cheese Mozzarella cheese and yoghurt This bacterium contributes to fast lactic aciddevelopment in yoghurt and also to its flavour and textural properties Naturally bacteria isolated from Iranianyoghurts are better adapted to climate of Iran and their products are perfectly matched to taste of Iraniancustomers The aim of present study was to isolate identify and characterize Lactobacillus bulgaricus fromIranian local yoghurts and then assess their potential to be used in dairy industries as yoghurt starters Sixty oneyoghurt samples from rural area from 15 provinces mainly Isfahan were collected and transferred tobiotechnology laboratory Isolates were identified to species level using morphological and biochemical testsincluding gram staining catalase spore formation growth of isolates in different temperatures and in thepresence of different concentration of NaCl and fermentation of different sugars PCR molecular method waspreformed aiming for more accurate identification of isolates to sub species level using primer pair of LB1 5 AAAAATGAAGTTGTTTAAAGTAGGTA 3 and LLB 5 AAGTCTCCTGGCTGG 3 In total 72 out of 102isolates characterized as Lactobacillus delbrueckii subsp bulgaricus and their potential to be used as starter inyoghurt processing were compared with 5 commercial strains purchased from CHR Hansen and Wisbymanufactures For assessment of potential of local starters to produce acid Skim milk 10 was inoculated bymicrobial suspension with OD650 1 and incubated at 42 C for 5h pH of samples were measured in 30 minintervals Standard loop test was carried out to determine the ability if different isolates to produce EPS Tocompare the performance of the local isolates with the industrial strains as yoghurt starter yoghurt wasproduced in the same conditions as industry i e at 42 C for 3h For this purpose 22 mL of starter mixture wereadded to 900 mL of milk In total 48 yoghurt sample were produced Starter mixture were contained a 1 1bacterial suspension if Lactobacillus bulgaricus and Streptococcus thermophillus in MRS and M17 brothrespectively with OD650 1 11 mL if each suspension Where two different Lactobacillus bulgaricus wereneeded based on purpose of the experiment 5 5 mL of each isolated suspension of the same OD650 were used The pH and acidity of yoghurt samples were reported at 3 24 72 168 and 360 hours during storage in threereplications Viscosity of samples was determined after one week in three replications Isolates were classifiedin 4 different groups high acid producers high EPS producers those which can produce acceptable level ofEPS and acid and finally those which are weak in acid and EPS production Some of local isolates were able toproduce yoghurts in very short time less then 180 min with suitable texture and in some case they were showedlow post acidification with a pH decrease of less then 0 3 units after 15 days of storage at 4 C Keywords Lactobacillus bulgaricus Local starter Exopolysaccharid PCR method
  • استاد راهنما
    محمود شيخ زين الدين، صبيحه سليمانيان زاد
  • استاد مشاور
    شهرام دخاني
  • استاد داور
    محمد فضيلتي، مهدي محمد علي پور